IK channel activation increases tumor growth and induces differential behavioral responses in two breast epithelial cell lines

MCF-10A and MDA-MB-231 cell line were purchased directly from ATCC which certified the identity of the cell lines by STR analysis and also certified the cell lines as pathogen-free. Cells were maintained following ATCC recommendations.

Cells were treated with 200 μM 1-EBIO diluted from a 400 mM 1-EBIO stock solution in dimethyl sulfoxide (DMSO) resulting in a final concentration of 0.05% DMSO in the cell medium. Control samples were treated with an equivalent concentration of DMSO as vehicle control.

Patch clamp recordings were performed in the cell attached perforated patch configuration and data were recorded with an Axon DigiData 1550 (Axon Instruments) data acquisition system and an Axopatch 200B (Molecular Devices) amplifier. Data were low pass filtered at 5 kHz, sampled at 50 kHz, and analyzed using pClamp 10 software (Axon Instruments). Patch pipettes were pulled from thin-wall borosilicate glass with a P-97 micropipette puller (Sutter Instruments) and fire polished resulting in 4-7 MΩ resistance pipettes. Pipettes were filled with intracellular electrode solution (5 mM NaCl, 145 mM KCl, 2 mM MgCl2, 1 mM CaCl2, 1.57 mM ethylene glycol-bis(2-aminoethylether)-N-N-N’-N’-tetraacetic acid (EGTA), 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES), pH adjusted to 7.4 with 1 M KOH) supplemented with 150 ng/ml Nystatin to induce pore formation. Prior to recording, cells plated on glass coverslips were perfused with external bath solution (144 mM NaCl, 5.4 mM KCl, 1 mM MgCl2, 2.5 mM CaCl2, 5.6 mM Glucose, 5mM HEPES, adjusted to pH 7.2 with 1 M NaOH). After initial seal formation, with a minimal seal resistance cut off of 1.0 GΩ, perforation was assayed by monitoring the capacitive current transient to a 2.5 mV step with -30 mV holding potential. Recordings were acquired once the series resistance was below 75 MΩ. Vmem recordings were taken for 30 seconds in control extracellular solution supplemented with vehicle control with no fluid-flow, during 30 seconds of bath exchange with the same solution, during 30 seconds of bath exchange with bath solution containing 200 uM 1-EBIO, and for 30 seconds in 200 μM 1-EBIO with no fluid flow. The reported Vmem values are the average from the last 20 seconds recorded in static fluid from each condition.

For the current-voltage protocol, cells were held at -30 mV followed by 50 ms test pulses between -120 mV and 80 mV in 40 mV steps. Current density was calculated by dividing the average current during the voltage step without leak subtraction by the whole cell capacitance.

RNA was isolated from confluent cells in a 6-well plate. Cells were rinsed with PBS and 200 μL RNA-later (Ambion) was added before scraping and transferring cells to a 1.5 mL tube. RNA was purified using an RNeasy mini kit (Qiagen) per manufacturer instructions. The concentration of RNA was determined with a NanoDrop 2000 (Thermo Scientific). Reverse transcription reactions were performed with 1 μg of RNA in a 20 μl reaction using iScript Reverse Transcription Supermix (Bio-Rad) following manufacturer instructions. Transcript expression levels were quantified with a Bio-Rad CFX96 Real Time System. Reactions were performed in 20 μL using iQ SYBR Green Supermix (Bio-Rad) and 40 ng cDNA with the following reaction conditions: 95°C 10 min, 40 cycles of 95°C 30 sec, 58°C 1 minute, 72 C° 1 minute. The primers used to amplify an IK fragment were forward primer 5′ CTGCTGCGTCTCTACCTGG and reverse primer 5′ AGGGTGCGTGTTCATGTAAAG and GAPDH was used as the housekeeping gene with forward primer 5′ TTCGACAGTCAGCCGCATCTTCTT and reverse primer 5′ ACCAAATCCGTTGACTCCGACCTT. To detect SK and compare to IK expression levels, QPCR was performed using Taqman probes (Thermo Scientific) for SK, IK, and GAPDH with Taqman universal master mix II (Thermo Scientific) following manufacturer's instructions.

MCF-10A cells were plated at 7.5 × 103 cells/cm2 and MDA-MB-231 cells were plated at 1 × 104 cells/cm2 in 6 well plates. Cells were allowed to attach in normal medium for 3 h followed by exchange to media supplemented with drug treatment. Cells were trypsinized and counted with a TC 10 automated cell counter (BioRad) daily for 4 days with a media change after 2 days.

Cells were plated at 5 × 104 cells/cm2 and allowed to attach for 3 hours. Medium was exchanged to medium supplemented with vehicle or 200 μM 1-EBIO and cells were incubated for 24 h. To quantify the percentage of apoptotic and dead cells, cells were trypsinized, washed in PBS, and incubated in 0.1% Live/Dead Fixable Violet Dead Cell stain for 30 min. Cells were washed in Annexin V Binding Buffer and incubated in Annexin V conjugated to FITC diluted 1:125 in Annexin V Binding Buffer (Invitrogen). For cell cycle analysis, cells were fixed in 70% ethanol and washed in phosphate-buffered saline (PBS). Cells were incubated in 50 ng/mL propidium iodide (Invitrogen), 250 ng/mL RNase diluted in PBS for 1hr. Cell fluorescence was detected using an LSR II (Becton Dickenson) fluorescent cell analyzer and data were analyzed with FlowJo software.

MDA-MB-231 cells were plated at 2.5 × 105 cells/cm2 in a 24 well plate and were serum starved in 1% FBS media overnight. A scratch was made with a yellow tip and medium was exchanged with low serum medium containing drug treatment. Phase contrast images were acquired of the initial scratch. 10 h post scratch, cells were incubated in 0.5 μg/mL calcein AM for 15 minutes and fluorescent images were acquired. ImageJ was used to calculate wound healing by first manually outlining the wound at time 0 hr to create a region of interest (ROI). The fluorescent 10 h image of calcein AM stained cells was converted to a binary image such that white pixels corresponded to the surface area covered by cells. The percentage of white pixels within the initial wound ROI was quantified to measure wound healing. Scratch assays with MF-10A cells were performed similarly but 24-well plates were seeded with 3.75 × 105 cells/cm2 cells, low serum medium consisted of normal MCF-10A medium with 0.5% horse serum and 2 ng/mL EGF, and bright field images were acquired 0 h and 12 h after scratching and the area of the scratch wound was measured with image J.

The day prior to invasion assays, cells were placed in low serum medium. Basement membrane coated transwells with 6.5 mm diameter and 8 μm pore size (BD Biosciences) were pre-incubated with 500 μL DMEM in the upper chamber for 2 hours. MDA-MB-231 cells were diluted to 2.5 × 105 cells/mL and MCF-10A cells were diluted to 5 × 105 cells/mL in low serum media and 200 μL of the cell suspension was placed in the upper chamber giving 5 × 104 and 1 × 105 cells per well respectively. The bottom chamber was filled with 600 μL of normal full serum media as a chemoattractant. After 16 h for MDA-MB-231 cells or 24 h for MCF-10A cells, transwells were rinsed in PBS and cells were scraped off of the upper chamber. Remaining cells were fixed in 4% PFA for 10 minutes. Transwells were rinsed in PBS and stained with 1 μg/mL 4′, 6-Diamidino-2-Phenylindole Dihydrochloride (DAPI) for 10 minutes. The number of invading cells was counted in 4 fields of view for each sample.

MCF-10A cells were plated at 3 × 104 cells per well and MDA-MB-231 were plated at 5 × 103 cells per well of a six well plate. The wells were first coated in 1.5 mL of 0.8% agarose diluted in normal culture media. Cells were plated in 1.5 mL of 0.4% agarose diluted in normal culture media and the agarose was allowed to set at room temperature for 1 hr. Samples were cultured for 4 weeks with 0.5 mL culture media added on top of the culture media with media exchanges every 2-3 days. After 4 weeks, samples were fixed in 10% formalin for 30 minutes and incubated in .005% crystal violet for 1 hr. Samples were rinsed in water until the washes were clear of stain. Images were acquired using a ChemiDoc XRS+ gel imager (BioRad) and associated software. Colonies were counted using ImageJ.

All procedures involving animals were approved by the University of York Ethical Review Process and under the authority of a UK Home Office project License. Six week old female Rag2−/−, Il2rg-/− mice (Yorkshire Cancer Research Unit, University of York) were selected at random for MDA-MB-231 control or MDA-MB-231-IK injection. A 5 × 105 cell suspension was prepared in 20% v/v matrigel in saline and injected into the left inguinal mammary fat pad of isoflurane anaesthetized mice. A total of 14 and 11 mice were injected with MDA-MB-231 control and MDA-MB-231-IK cells respectively across 4 independent experiments. Tumors did not take in 3 of the control and 2 of the IK expressing mice and were not included in analysis giving n = 11 for MDA-MB-231 control and n = 9 for MDA-MB-231-IK. The length and width of primary tumors was measured daily with calipers and the tumor volume was calculated as 0.5 × (length × width2). Mice were euthanized 28 days after injection and tumors and lungs were fixed in 4% paraformaldehyde and frozen.

H&E staining and immunohistochemistry were performed as described [39]. The following primary antibodies were used: mouse anti-IK (1:20; Alomone); rabbit anti-Ki67 (1:5000; Abcam); rabbit anti-activated caspase-3 (1:200; R&D Systems); rabbit anti-CD31 (Santa Cruz Biotechnology); mouse anti-HNA (1:100; Millipore). Secondary antibodies were Alexa-488-conjugated goat anti mouse/rabbit (1:500; Invitrogen). Samples were mounted in Prolong Gold with DAPI (Invitrogen). Sections were scanned at 20X using a Zeiss AxioScan.Z1 slide scanner. Images were exported into ImageJ for processing. Brightness/contrast was adjusted using the ImageJ “Auto” function. Density of Ki67+ or activated caspase-3+ cells, CD31+ vessel structures, and metastasis to lungs were measured across scanned images of whole sections, blinded to treatment [39, 40].

Statistics were analyzed in Prism 5 and significance was determined using a two sample t-test or a one-way ANOVA followed by either a Dunett post test (to compare multiple conditions to a single control) or a Tukey post test (for a comparison of all conditions), alpha = 0.05. In cases where a comparison is made between two specific conditions from within an ANOVA the q value is given, otherwise only the p-value is given. All results are presented as mean with standard deviation from 3 independent experiments unless otherwise noted.